Pthr31625

Author: mfge

August undefined, 2024

Web1.7E 110) of the PANTHER domain PTHR31625, which has to date only been detected in plant and fungal proteins (3,073 sequences) and one bacterial protein (GenBank: KPK61911) http://cucurbitgenomics.org/v2/feature/gene/Moc02g05650

phylogenetic analysis ppt

WebConsolidated transcript/protein view: LotjaGi1g1v0514200.1 is a Anthocyanin 5-aromatic acyltransferase; TAIR: AT3G29590.1 HXXXD-type acyl-transferase family protein; Swiss-Prot: sp Q9ZWR8 ANTA_GENTR Anthocyanin 5-aromatic acyltransferase; TrEMBL-Plants: tr G7L657 G7L657_MEDTR Anthocyanin 5-aromatic acyltransferase; Found in the gene: … WebThe SER 3225 P 16 is produced by Pramet and is described as a Pramet SER 3225 P 16 6756973 Turning Toolholder - Threading molly sheridan

Evidence for the horizontal transfer of BtPMaT1 in B. tabaci

WebHold the cursor over a type above to highlight its positions in the sequence below. GTCTGTGTATTTCTATAGCGTTTCATCACGTGGTTGCCGACGGGATGGCCGCTCACGATTTCCTCAAATCATGAG WebApr 1, 2024 · BtPMaT1 of B. tabaci clusters, together with BtPMaT2, within a group of plant BAHD acyltransferases containing the PTHR31625 domain. The tree is midpoint rooted, … InterPro provides functional analysis of proteins by classifying them into families and predicting domains and important sites. We combine protein signatures from a number of member databases into a single searchable resource, capitalising on their individual strengths to produce a powerful integrated database and diagnostic tool. hy vee grocery adspeoria il

Pthr31625

http://www.pantherdb.org/panther/family.do?clsAccession=PTHR31625 WebName: CmaCh20G009130: Type: gene: Organism: Cucurbita maxima (Cucurbita maxima (Rimu)): Description: HXXXD-type acyl-transferase family protein, putative: Location ...

Did you know?

WebApr 27, 2024 · About us. Developed with the end-user in mind, Lotus Base is an user-friendly web interface that brings together various resources, tools and datasets available for the model legu WebHold the cursor over a type above to highlight its positions in the sequence below.

http://cucurbitgenomics.org/feature/gene/Csa7G343340 Web1 mvneemessl kvidvarvtp snsdsseslt lpltffdllw yklhavervi 51 fykltdasrp ffdsvivpnl ktslssslsh ylplagklvw epldpkpkiv 101 ytpndavsft vaesnadfsr ltgkepfptt elyplvpelh ...

WebMany plants contain phenolic glycosides that are toxic for insect herbivores. •Whitefly carries a plant-derived phenolic glucoside malonyltransferase gene BtPMaT1. • BtPMaT1 enables whiteflies to neutralize phenolic glycosides in host plants. •Plant-mediated silencing of BtPMaT1 confers tomato full resistance to whiteflies. http://cucurbitgenomics.org/feature/gene/Cla97C09G171570

WebConsolidated transcript/protein view: LotjaGi1g1v0514100.1 is a Anthocyanin 5-aromatic acyltransferase; TAIR: AT5G39050.1 HXXXD-type acyl-transferase family protein; Swiss-Prot: sp Q940Z5 PMAT1_ARATH Phenolic glucoside malonyltransferase 1; TrEMBL-Plants: tr G7L650 G7L650_MEDTR Anthocyanin 5-aromatic acyltransferase; Found in the gene: … molly sheron gynWebConsolidated domain prediction view: PTHR31625 (PANTHER), a . About us. Developed with the end-user in mind, Lotus Base is an user-friendly web interface that brings together … molly sherlock crsWebAn InterProScan search ( Jones et al., 2014) of BtPMaT1 revealed the presence (E-value of 1.7EÀ110) of the PANTHER domain PTHR31625, which has to date only been detected in plant and fungal ... hy vee grocery delivery omahaWebThe spatio-temporal expression pattern of BtPMaT1 was monitored with real-time quantitative PCR (qPCR) using five developmental stages (eggs, 1 st –2 nd, 3 rd, and 4 th … molly sheron npWebpthr31625 8-343: panther. pthr31625:sf52 8-343: hmmpfam. pf02458. transferase:ipr003480 10-335: gene3d. 3.30.559.10. cat-like_dom_sf:ipr023213 244-344: sequence 1 maaqlqpyni ietchisppk gtvasttlpl tffdapwlsl pladslfffs 51 yqnstesflq dfvpnlkhsl sitlqhffpy agkliipprp dppylhynag molly sherryWebBtPMaT1 contains the PANTHER domain PTHR31625, which has to date only been detected in plant and fungal proteins (and one bacterial protein). 3. A maximum likelihood … molly shermanWebFunction. Phenolic glucoside malonyltransferase that neutralizes phenolic glycosides in host plants ( PubMed: 33770502 ). Catalyzes the transfer of a malonyl group from malonyl-CoA to the phenolic glycosides, leading to their detoxification ( PubMed: 33770502 ). Phenolic glycosides, which are among the most abundant plant secondary metabolites ... molly sheron